Journal of biological and health sciences http://biotecnia.unison.mx
ISSN: 1665-1456
Estandarización de una prueba isotérmica como una nueva herramienta diagnóstica en México para la detección molecular de Chlamydia abortus en pequeños rumiantes
1
2
3
Departamento de Ciencias Agronómicas y Veterinarias del Instituto Tecnológico de Sonora, 5 de febrero 818 south. ZC 85130. Obregon City, Sonora, Mexico.
Centro de Investigación Nacional Interdisciplinaria en Salud Animal e Inocuidad of the Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP). ZC 05110, Mexico City.
Facultad de Medicina Veterinaria y Zootecnia de la Universidad Nacional Autónoma de México (FMVZ-UNAM). ZC 04510, Mexico City.
Ovine Enzootic Abortion (OEA) is caused by Chlamydia abor- tus and has recently been recognized as endemic in Mexico. Due to the impact of OEA on intensive lamb production, it is necessary to establish a sanitary control plan based on an efficient diagnosis. The loop-mediated isothermal amplifica- tion technique (LAMP) is a molecular test that can specifically identify C. abortus. The aim of this study was to standardize the LAMP technique for the specific detection of C. abortus in ovine vaginal exudates. Primers were identified and mo- dified from an electronic database. The effective conditions of the technique were determined using synthetic DNA and positive biological samples by PCR as references. The assay detection limit was 1 × 10-5 of genetic material, equivalent to 8.5 copies. The standardized LAMP test is proposed as a novel molecular tool for the rapid and specific diagnosis of
C. abortus infection from ovine vaginal exudate samples in Mexico.
Enzootic Abortion.
El Aborto Enzoótico Ovino (AEO) es causado por Chlamydia abortus y ha sido reconocido recientemente como endémico en México. Debido al impacto del AEO en la producción inten- siva de corderos, es necesario establecer un plan de control sanitario basado en un diagnóstico eficiente. La técnica de amplificación isotérmica mediada por bucle (LAMP) es una prueba molecular que puede identificar específicamente a C. abortus. El objetivo de este estudio fue estandarizar la técnica de LAMP para la detección específica de C. abortus a partir de exudado vaginal ovino. Los cebadores fueron identificados y modificados a partir de una base de datos electrónica. Las condiciones efectivas de la técnica se determinaron con ADN sintético y de muestras biológicas positivas por PCR como
*Author for correspondence: Marcela Ivone Morales-Pablos e-mail: marcela.morales@itson.edu.mx
referencia. El límite de detección de la prueba fue de 1 × 10-5 de material genético, equivalente a 8.5 copias. Se propone el test de LAMP estandarizado como una nueva herramienta molecular para el diagnóstico rápido y específico de la infec- ción por C. abortus a partir de muestras de exudado vaginal ovino en México.
Palabras clave: Chlamydia abortus, ompA gene, LAMP, Abor- to Enzótico Ovino.
The most common cause of infectious abortion in sheep flocks is Ovine Enzootic Abortion (OEA), which has significant economic and productivity implications in intensive lamb production. The causative agent is Chlamydia abortus, an obligate intracellular gram-negative bacterium (Selim, 2016). Abortive diseases in small ruminants pose a major problem in sheep farming (Benavides Ortíz, 2009), as abortion cases con- tribute to economic losses due to failed calving (Palomares- Reséndiz et al., 2020). Besides being a zoonotic disease, OEA is the most common infectious cause of abortion in sheep worldwide, leading to productivity losses (Selim, 2016). The- refore, OEA is recognized as a constraint to the expansion of the sheep industry and international trade of sheep products (Benavides Ortíz, 2009). The first report of abortive chla- mydiosis in small ruminants in Mexico was in 1996, and in 2016, OEA was recognized as an endemic disease (Escalante et al., 1996; DOF, 2016). During this time, the disease spread throughout the country due to animal movements for gene- tic improvement purposes. In 2020, an individual and herd- level seroprevalence of 10.92 % and 43.34 % for C. abortus, respectively, was reported in Mexico (Palomares-Reséndiz et al., 2020). The background and epidemiological behavior of the disease highlight its relevance in sheep production if it is not controlled in the coming years.
Volume XXVI, Issue 1
To prevent, control, and reduce economic losses from abortive diseases in lamb production, good management practices, as well as early and accurate pathogen detec- tion, are necessary (Yeh et al., 2005). As the sheep industry expands, laboratories must be equipped with diagnostic tools to differentiate abortifacient diseases (Benavides-Ortíz, 2009). However, the intracellular lifestyle of C. abortus poses challenges for isolation, culture, and identification (Bush and Everett, 2001). Additionally, serological detection in animals is limited by non-specificity caused by cross-reactivity with other Chlamydia species (Selim, 2016). Conventional diag- nostic methodologies such as cell culture and serology have limitations in early detection for optimal epidemiological di- sease control. Due to the lack of specificity and low sensitivity of these methods, we are unable to accurately determine the magnitude of the problem.
Molecular assays can discriminate between different bacterial causes of abortions in ewes, even to distinguish among Chlamydia species (Reisberg et al., 2013). Implemen- ting a more reliable diagnosis in flock biosecurity programs for the sanitary control of C. abortus requires the standar- dization of molecular tests. For instance, Polymerase Chain Reaction (PCR) requires sophisticated and costly tools for amplification and detection of the target DNA (Fakruddin, 2011). PCR is also susceptible to contaminants from different sources, and sample preparation is needed to remove ampli- fication inhibitors (Corless et al., 2000).
As an alternative, Loop-Mediated Isothermal Amplifica- tion (LAMP) is a recent molecular method for the identifica- tion of microorganisms. This technique is based on the prin- ciple of strand displacement activity, allowing amplification of the target DNA using a set of specially designed primers with high specificity and efficiency, even at low concentra- tions of genetic material (Saharan et al., 2014; Hardinge and Murray, 2019). Furthermore, its isothermal feature eliminates the need for expensive thermal cyclers used in PCR, making it a potentially useful and cost-effective method for diagno- sing infectious diseases in faraway or vulnerable sectors. In México, sheep production is a system that requires technical advancements to improve efficiency (Hernández-Marin et al., 2017), and animal health is essential for sustainability. Howe- ver, standardizing a molecular diagnostic technique is crucial as factors such as temperature, primer ratio, reaction time, and concentrations of MgCl2, deoxynucleotide triphosphates (dNTPs), and betaine significantly affect the reaction (Ihira et al., 2004; Yeh et al., 2005). LAMP offers optimization in terms of time and resources required, making it an efficient and cost-effective test for molecular detection of C. abortus. Therefore, it is necessary to standardize the conditions for a reliable and feasible LAMP test to ensure specific detection of
C. abortus from vaginal exudate.
For the positive control (CTRL+) design, the primers for C. abortus (Chla-LAMP) previously proposed by Lin et al. (2011)
were selected. The primers (Table 1) were visualized in Sna- pGene Viewer software and aligned to different sequences of the ompA gene that encodes for the Major Outer Membrane Protein (MOMP), published in different strains of Chlamydia abortus (GenBank® accession numbers DQ471955.1, HQ622433.1, EU086705.1, and EF202609.1).
The specificity of the primers was validated in silico by the Primer-BLAST (GenBank® software) from the National Center for Biotechnology Information (NCBI) database. For the CTRL+ synthesis, the DQ471955.1 sequence was down- loaded in FASTA format as a result of the alignment using the selected primers. With the SnapGene Viewer visualization software, the generated sequence from the alignment was selected considering 50 base pairs (bp) upstream of the Chla/ F3 primer and 50 bp downstream of the Chla/B3 primer from the CTRL+. This sequence and the selected primer set, were synthesized at IDT (Integrated DNA Technologies, USA).
Table 1. Primers for amplification of the C. abortus ompA gene.
Tabla 1. Cebadores para la amplificación del gen ompA de C. abortus.
Primers | Sequences |
Chla/F3 | ACCTCTAACAGCTGGTACTG |
Chla/B3 | TGGGTTCCATGTGGTCAAG |
Chla/FIP | GAGAGCGCTAAACCAACTTGC-CAACTGACACTAAGTCGGC |
Chla/BIP | GGCATAAACTGGTCACGAGCA-ATTTAGGTTGAGCGATGCGG |
The setting of the LAMP reaction for the detection of the C. abortus ompA gene (Chla-LAMP), was carried out with the primer set as described in table 1 in a 25 µL reaction system. The reagent concentrations used were as follows: Chla/F3 and Chla/B3 at 0.1 mM; Chla/FIP and Chla/BIP at 0.8 mM; F2 and B2 at 0.4 mM; 0.2 M betaine; 0.8 mM MgSO4; 0. 2 mM dNTPs; 1 X BST regulator; 0.8 units of BST (2.0 WarmStart DNA Polymerase) enzyme of final concentration, and 10 ng of DNA template were added at the end of the reaction mixture. Afterward, the temperature and time conditions were stan- dardized and determined in a mini incubator (Bio-Rad™) at 62 °C for 30 to 60 m. The visualization of amplified products was analyzed by electrophoresis (1.5 % agarose gel) through visual observation using ethidium bromide (Sigma Aldrich®). Once the results were satisfactory, the protocol was validated in triplicate.
To corroborate the standardization from CTRL+, Chla- LAMP was tested with five DNA samples previously confir- med by PCR as positive for C. abortus. The positive samples were provided by the Centro de Investigación Nacional Interdisciplinaria en Salud Animal e Inocuidad (CENID) of the Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP) in Mexico City.
From the Chla-LAMP standardization results the analytical sensitivity assay was assessed subjecting the CTRL+ to diffe-
rent gradients of the concentration. Six 1:9 serial dilutions of CTRL+ (5 to 10 e-7 ng/µL dilution) were performed to deter- mine the assay’s limit of detection.
In a commercial flock with a history of abortions and sugges- tive signs to C. abortus (Eg. tearing, weak in offspring, stillbir- ths, placentitis) located in the Yaqui Valley, Sonora, Mexico, 48 ewes (>12 months) were randomly selected. A sterile swab was introduced into the vagina of each ewe and with circular movement the vaginal wall was rubbed to obtain the maximum quantity of exudate. Then, the swab was placed into 1.5 mL vials with phosphate-buffered saline and shipped at 5 °C to the laboratory.
During sampling, the animals’ integrity was not com- promised at any time and this procedure was approved by an ethics committee in accordance with the Mexican Official Standard NOM-062-ZOO-1999.
The samples were first homogenized by agitation and inver- sion. Afterward, the DNA extractions were carried out by the taco™ Nucleic Acid Automatic Extraction System (GeneReach Biotechnology Corp.) using the taco™ DNA/RNA Extraction Kit according to the manufacturer’s method. The final extrac- ted product of nucleic acids was quantified and counted with UV spectrophotometry (BioSpect-Nano, Shimadzu®). The in- tegrity of the extracted DNA was verified by electrophoresis in a 1.5 % agarose gel stained with ethidium bromide. All the extractions were stored in 1.5 mL sterile vials at -20 °C to be subsequently processed for the Chla-LAMP technique.
Once the genetic material was extracted, C. abortus detec- tion was performed following the Chla-LAMP protocol as previously described in the standardization section. The products were visually detected by electrophoresis in 1.5 % agarose gel using a load buffer (Blue-orange®, Promega) and ethidium bromide.
The product of the CTRL+ synthesis yielded a sequence of 316 bp corresponding to a fragment of the ompA gene that codifies for the MOMP protein of C. abortus, and was positioned between the 687 and 938 nucleotides from the start codon of the reading frame of the gene (Figure 1). The CTRL+ had 100 % of homology to the sequence reported in NCBI GenBank® and was recognized with the identifier DQ471955.1.
The LAMP assay to detect C. abortus with the primers that recognize the targeted ompA gene displayed conditions of
Figure 1. Diagram of primers and their alignment in specific C. abortus
ompA sequence.
Figura 1. Diagrama de cebadores y su alineación en secuencia específica de
C. abortus ompA.
Fuchsia-coloured arrows indicate the direction and site recognized by the primers in the sequence of the synthetic positive control (CTRL+) and the name. The letters in fuchsia indicate the name of the primers.
optimal amplification. The reaction was visualized after 30 minutes, but for better visualization in agarose gel, it was determined at 40 min (Figure 2). The amplification products were observed on agarose gels in different sizes, which are distinctive for LAMP assays (Figure 3).
The limit of detection in the Chla-LAMP assay was 5 × 10-5 ng of the synthesized genetic material (Figure 4). The amount of acid nucleic represented 8.5 genomes equivalent to 30,893 copies of the sequence (316 bp of an ompA gene fragment) that codifies for the MOMP protein of C. abortus.
The Chla-LAMP reaction to detect C. abortus DNA from vagi- nal swabs was carried out under optimal conditions. The best reaction was achieved at 62 °C for 40 min, which detected
81.25 % (39/48) of the animals with the presence of genomic material of C. abortus (Figure 5).
Figure 2. Visualization of LAMP assay for C. abortus detection using ompA gene primers at different amplification timepoints.
Figura 2. Visualización del ensayo LAMP para la detección de C. abortus utilizando cebadores del gen ompA en diferentes momentos de amplificación.
Tracks 1= negative control at 30 min, 2 = negative control at 40 min, 3 = negative control at 50 min; negative control at 4 = 60 min, M = kb molecular marker 1 kb, 5 = CTRL+ at 30 min, 6 = CTRL+ at 40 min, 7 = CTRL+ at 50 min,
and 8= CTRL+ at 60 min.
Figure 3. Agarose gel with LAMP product for the amplification of the synthe- tic DNA and ompA gene.
Figura 3. Gel de agarosa con producto LAMP para la amplificación del ADN sintético y gen ompA.
Tracks 1 = 1 kb molecular marker; 2 = Negative control; 3 = Positive control (CTRL+); 4 = Biological sample of C. abortus.
Figure 4. Sensitivity analysis of Chla-LAMP assay by DNA concentration gradient.
Figura 4. Análisis de sensibilidad del ensayo Chla-LAMP por gradiente de concentración de ADN.
DNA concentration in tracks from 1 to 13 = 5.00E00, 1.00E00, 5.00E-01, 1.00E-01, 5.00E-02, 1.00E-02, 5.00E-03, 1.00E-03, 5.00E-04, 1.00E-04, 5.00E-
05, 1.00E-05 and 5.00E-06 ng/µL respectively. Track 14 = negative control.
Figure 5. Chla-LAMP amplification of C. abortus DNA from vaginal samples. Figura 5. Amplificación de Chla-LAMP de ADN de C. abortus de muestras vaginales.
Tracks 1= 1 kb molecular marker, 2= CTRL+, 3= negative control; from 4 to 13= LAMP product with biological samples.
The multiple alignment sequences of the Chla-LAMP exter- nal primers (F3/Chla and B3/Chla) in the Primer-BLAST tool, exhibited high in silico homology with sequences matching Chlamydia abortus. A lower homology was observed for Chlamydia psittaci, an isolated pathogen in poultry and other birds (Li et al., 2016). No homology was identified with other organisms, ensuring that the primers in the current assay specifically target C. abortus DNA. The ompA gene sequence chosen as the target in this study can discriminate serotypes, species, and antigens specific to the genus and species within the Chlamydiaceae family (Conlan et al., 1988; Salti- Montesanto et al., 1997). Primers designed from pmp genes are reported to improve the molecular diagnosis of Chla- mydias in sheep (Laroucau et al., 2001). However, these genes exhibit short-term variability (Read et al., 2003), leading to the hypothesis that primers designed from these sequences may require recurrent updates compared to ompA genes. In contrast, the ompA gene has nearly 100 % conservation of its ompA sequences (Everett et al., 1999), suggesting that these primers will be more durable and enable the discovery of new strains of C. abortus.
Additionally, like the ompA primers, the designed pri- mers for C. abortus pmp genes are also proposed as a tool for the detection of C. psittaci (Laroucau et al., 2007). However, it should be noted that the use of ompA primers may indi- cate a lack of specificity for C. abortus. Even with nucleotide alignment search tools, the Chla-LAMP primers showed alig- nment with both organisms. Therefore, it is recommended to explore alternative sequences or molecular markers that can provide better specificity for identifying C. abortus. This can help ensure accurate and reliable detection of C. abortus without potential cross-reactivity with other Chlamydias.
The use of synthetic sequences as positive controls is crucial for the detection of microorganisms. This allows for standardization, and the determination of detection limits in diagnostic panels, ensuring accurate detection and mini- mizing false negative results. Recently, the use of synthetic fragments has been reported for the detection of zoonotic bacteria such as Escherichia coli, Enterococcus faecalis, and Legionella pneumophila (Cardenas, 2018). Also, synthetic sequences have been used as standards in the multiplex PCR detection of Taenia spp. (Ng-Nguyen et al., 2017) and for the molecular identification of Ehrlichia canis, Anaplasma platys, and Rickettsia rickettsii (Aragón-López et al., 2021). Therefore, the use of synthesized positive sequences in the standardiza- tion of molecular assays enhances the efficiency of bioassays for detection, especially when biological isolates are not readily available.
During the standardization of the Chla-LAMP assay, the reaction was visualized on agarose gels within the first 30 min. However, at 40 min the visualization became sharper and more stable. Reactions longer than 60 m sometimes result in false positives due to the impact of template con- centration on amplification time. Additionally, prolonged re- actions with low-purity primers may also yield false positives
(Hardinge and Murray, 2019). Therefore, it is recommended to work with a positive synthetic control to minimize templa- te concentration variations.
In another study comparing LAMP with conventional nested PCR for Chlamydia detection and chick embryo iso- lation, the assay exhibited the same sensitivity with a limit of detection of 4 genomic copies and higher to the chick embryo isolation (Lin et al., 2011). Other analyses reported sensitivity limits of up to 10 and 25 genomes per reaction (Halse et al., 2006; Appelt et al., 2019). However, Chla-LAMP demonstrated equal or better sensitivity compared to Ashraf et al. (2018), who reported detection limits of 1e-04 and 1e-05 ng of genetic material from pure cultures and DNA extrac- tions from milk samples, respectively.
A LAMP assay was standardized for the fast and accurate detection of the ompA gene of C. abortus. This test was successfully validated, using DNA extracted from the vaginal exudate of ewes from flocks with a history of C. abortus- induced abortions, and confirmed by PCR. The standardized Chla-LAMP assay demonstrated specificity, sensitivity, and accuracy in detecting Chlamydia abortus in infected sheep, with no risk of cross-contamination with other Chlamydias. LAMP is considered a novel methodology that could be va- luable for biosecurity protocols in intensive lamb production.
The authors express great gratitude to all sheep producers in Sonora, Mexico for their trust and support over the past years.
The authors of this study declare no conflict of interest.
For the ethical standards and statement of animal rights in this study, the Research Committee of the Department of Agronomic and Veterinary Sciences of the Instituto Tecnolo- gico de Sonora approved the procedures used in this study, which were in accordance with the Mexican Official Standard NOM-062-ZOO-1999 for the production, care, and use of experimental animals.
Appelt, S., Aly, S. S., Tonooka, K., Glenn, K., Xue, Z., Lehenbauer,
T. W., and Marco, M. L. 2019. Development and comparison of loop-mediated isothermal amplification and quantitative polymerase chain reaction assays for the detection of Mycoplasma bovis in milk. Journal of Dairy Science, 102(3), 1985-1996. https://doi.org/10.3168/jds.2018-15306
Aragón-López, C., Luna-Nevárez, P., Ortiz-Encinas, V., Leyva- Corona, J., Cantú-Soto, E., and Reyna-Granados, J. 2021. Detección molecular de Ehrlichia canis, Anaplasma platys
y Rickettsia rickettsii en caninos domésticos del municipio de Cajeme, Sonora, México. Abanico Veterinario, 11. http:// dx.doi.org/10.21929/abavet2021.45
Ashraf, A., Imran, M., Yaqub, T., Tayyab, M., Shehzad, W., Mingala,
C. N., and Chang, Y. F. 2018. Development and validation of a loop-mediated isothermal amplification assay for the detection of Mycoplasma bovis in mastitic milk. Folia Microbiologica, 63(3), 373-380. https://doi.org/10.1007/ s12223-017-0576-x
Benavides-Ortíz, E. 2009. Principales enfermedades que afectan la producción ovina en el trópico. Spei Domus, 5(11), 32-36. Recovered from de https://revistas.ucc.edu.co/index.php/ sp/article/view/594
Bush, R. M., and Everett, K. D. E. 2001. Molecular evolution of the Chlamydiaceae. International Journal of Systematic and Evolutionary Microbiology, 51(1), 203-220. https://doi. org/10.1099/00207713-51-1-203
Cardenas, Y. 2018. Determinación de la contaminación microbiológica del agua de riego aplicando nuevas estrategias de análisis (Doctoral dissertation, Tesis de doctorado, Universidad de Barcelona. España. http://hdl. handle.net/10803/586307
Conlan, J. W., Clarke, I. N., and Ward, M. E. 1988. Epitope mapping with solid-phase peptides: identification of type-, subspecies-, species- and genus-reactive antibody binding domains on the major outer membrane protein of Chlamydia trachomatis. Molecular Microbiology, 2(5), 673-679. https:// doi.org/10.1111/J.1365-2958.1988.TB00076.X
Corless, C. E., Guiver, M., Borrow, R., Edwards-Jones, V., Kaczmarski, E. B., and Fox, A. J. 2000. Contamination and sensitivity issues with a real-time universal 16s rRNA PCR. Journal of Clinical Microbiology, 38(5), 1747-1752. https:// doi.org/10.1128/jcm.38.5.1747-1752.2000
Diario Oficial de la Federación 2016. Acuerdo mediante el cual se dan a conocer en los Estados Unidos Mexicanos las enfermedades y plagas exóticas y endémicas de notificación obligatoria de los animales terrestres y acuáticos. SEGOB. México. Recovered from: http://www.dof.gob.mx/nota_to_ doc.php?codnota=5436016
Escalante-Ochoa, C., Rivera-Flores, A., Trigo-Tavera, F., and Romero-Martínez, J. 1996. Detection of Chlamydia psittaci in enteric subclinical infections in adult sheep, through cell culture isolation. Revista Latinoamericana de Microbiologia, 38(1), 17-23. https://pubmed.ncbi.nlm.nih.gov/8783901/
Everett, K. D. E., Bush, R. M., and Andersen, A. A. 1999. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards. International Journal of Systematic Bacteriology, 49(2), 415-440. https://doi. org/10.1099/00207713-49-2-415
Fakruddin, M. D. 2011. Loop mediated isothermal amplification (LAMP)–an alternative to polymerase chain reaction (PCR). Bangladesh Research Publications Journal, 5(4). http://www.bdresearchpublications.com/admin/journal/ upload/09235/09235.pdf
Halse, T. A., Musser, K. A., and Limberger, R. J. 2006. A multiplexed real-time PCR assay for rapid detection of Chlamydia trachomatis and identification of serovar L-2, the major cause of Lymphogranuloma venereum in New York. Molecular and
Cellular Probes, 20(5), 290-297. https://doi.org/10.1016/j. mcp.2006.02.003
Hardinge, P., and Murray, J. A. H. 2019. Reduced false positives and improved reporting of Loop-Mediated Isothermal Amplification using Quenched Fluorescent Primers. Scientific Reports, 9(1), 1-13. https://doi.org/10.1038/ s41598-019-43817-z
Hernández-Marin, J. A., Valencia-Posadas, M., Ruíz-Nieto, J. E., Mireles-Arriaga, A. I., Cortez-Romero, C., and Gallegos- Sánchez, J. 2017. Contribution of sheep breeding to the livestock sector in Mexico. Agroproductividad, 10(3), 87–93. https://revista-agroproductividad.org/index.php/ agroproductividad/article/view/975?source=/index.php/ agroproductividad/article/view/975#:~:text=https%3A// r e v i s t a - a g r o p r o d u c t i v i d a d . o r g / i n d e x . p h p / agroproductividad/article/view/975
Ihira, M., Yoshikawa, T., Enomoto, Y., Akimoto, S., Ohashi, M., Suga, S., Nishimura, N., Ozaki, T., Nishiyama, Y., Notomi, T., Ohta, Y., and Asano, Y. 2004. Rapid diagnosis of human herpesvirus 6 infection by a novel DNA amplification method, Loop- Mediated Isothermal Amplification. Journal of Clinical Microbiology, 42(1), 140-145. https://doi.org/10.1128/ JCM.42.1.140-145.2004
Laroucau, K., Souriau, A., and Rodolakis, A. 2001. Improved sensitivity of PCR for Chlamydophila using pmp genes. Veterinary Microbiology, 82(2), 155-164. https://doi. org/10.1016/S0378-1135(01)00381-9
Laroucau, K., Trichereau, A., Vorimore, F., and Mahé, A. M. 2007. A pmp genes-based PCR as a valuable tool for the diagnosis of avian chlamydiosis. Veterinary Microbiology, 121(1–2), 150-
157. https://doi.org/10.1016/j.vetmic.2006.11.013
Li, J., Guo, W., Kaltenboeck, B., Sachse, K., Yang, Y., Lu, G., Zhang,
J., Luan, L., You, J., Huang, K., Qiu, H., Wang, Y., Li, M., Yang, Z., and Wang, C. 2016. Chlamydia pecorum is the endemic intestinal species in cattle while C. gallinacea, C. psittaci and C. pneumoniae associate with sporadic systemic infection. Veterinary Microbiology, 193, 93-99. https://doi. org/10.1016/j.vetmic.2016.08.008
Lin, G.-Z., Zheng, F.-Y., Zhou, J.-Z., Wang, G.-H., Cao, X.-A., Gong,
X.-W., and Qiu, C.-Q. 2011. Loop-Mediated Isothermal Amplification Assay targeting the MOMP gene for rapid detection of Chlamydia psittaci abortus strain. Pakistan Veterinary Journal, 32(2), 273-276: https://www. researchgate.net/publication/267803405
NG-Nguyen, D., Stevenson, M. A., Dorny, P., Gabriël, S., Vo, T. V.,
Nguyen, V-A. T., Phan, T. V., Hii, S. F., and Traub, R. J. 2017. Comparison of a new multiplex real-time PCR withthe Kato Katzthick smear and copro-antigen ELISA for the detection and differentiation of Taenia spp. in human stools. PLoS Neglected Tropical Diseases. 11(7):e0005743. https://doi. org/10.1371/journal.pntd.0005743
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., and Hase, T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), e63. https://watermark.silverchair.com/2800e63.pdf?token=A QECAHi208BE49Ooan9kkhW_Ercy7Dm3ZL_9Cf3qfKAc48 5ysgAAAmYwggJiBgkqhkiG9w0BBwagggJTMIICTwIBADC CAkgGCSqGSIb3DQEHA-TAeBglghkgBZQMEAS4wEQQM
y3AQPdcwVpshAVuIAgEQgIICGSfU5ehJRqbIy2A_4pd12_ oNbrQem7FM_kTE9ZYQL40XC4l
Palomares-Reséndiz, E. G., Mejía-Sánchez, P., Aguilar-Romero, F., De la Cruz-Colín, L., Jimé-nez-Severiano, H., Leyva-Corona,
J. C., Morales-Pablos, M. I., and Díaz-Aparicio, E. 2020. Frecuencia y factores de riesgo asociados a la presencia de Chlamydia abortus, en rebaños ovinos en México. Re-vista Mexicana de Ciencias Pecuarias, 11(3), 783-794. https://doi. org/10.22319/rmcp.v11i3.5269
Read T. D., G. S. A. Myers, R. C. Brunham, W. C. Nelson, I. T. Paulsen,
J. Heidelberg, E. Holtzapple, H. Khouri, N. B. Federova, H. A. Carty, L. A. Umayam, D. H. Haft, J. Peterson, M. J. Beanan,
O. White, S. L. Salzberg, R. C. Hsia, G. McClarty, R. G. Rank, Bavoil P. M., and Fraser C. M. 2003. Genome sequence of Chlamydophila caviae (Chlamydia psittaci GPIC): Examining the role of niche-specific genes in the evolution of the Chlamydiaceae. Nucleic Acids Research, 31(8), 2134-2147. https://doi.org/10.1093/nar/gkg321
Reisberg, K., Selim, A. M., and Gaede, W. 2013. Simultaneous detection of Chlamydia spp., Coxiella burnetii, and Neospora caninum in abortion material of ruminants by multiplex real-time polymerase chain reaction. Journal of Veterinary Diagnostic Investigation, 25(5), 614-619. https:// doi.org/10.1177/1040638713497483
Salti-Montesanto V, Tsoli E, Papavassiliou P, Psarrou E, Markey BK, Jones GE, and Vretou E. 1997. Di-agnosis of ovine enzootic abortion, using a competitive ELISA based on monoclonal antibodies against variable segments 1 and 2 of the major outer membrane protein of Chlamydia psittaci serotype
1. American Journal of Veterinary Research, 58(3):228-235. https://pubmed.ncbi.nlm.nih.gov/9055966/
Saharan, P., Dhingolia, S., Khatri, P., Singh Duhan, J., and Kumar Gahlawat, S. 2014. Loop-mediated isothermal amplification (LAMP) based detection of bacteria: A Review. African Journal of Biotech-nology, 13(19), 1920-1928. https://doi. org/10.5897/ajb2013.13459
Selim, A. 2016. Chlamydophila abortus infection in small ruminants: A review. Asian Journal of Animal and Veterinary Advances, 11(10), 587-593. https://doi.org/10.3923/ ajava.2016.587.593
Yeh, H. Y., Shoemaker, C. A., and Klesius, P. H. 2005. Evaluation of a loop-mediated isothermal ampli-fication method for rapid detection of channel catfish Ictalurus punctatus important bacterial pathogen Edwardsiella ictaluri. Journal of Microbiological Methods, 63(1), 36-44. https://doi. org/10.1016/j.mimet.2005.02.015