Journal of biological and health sciences http://biotecnia.unison.mx
Universidad de Sonora
ISSN: 1665-1456
Original Article
Implementación del genotipado rhAmp SNP para la detección de la mutación en el gen B3GALNT2 asociada a hidrocefalia congénita en caballos Friesian del sur de Sonora
1 Depto. de Ciencias Agronómicas y Veterinarias, Instituto Tecnológico de Sonora, Ciudad Obregón, SON 85000, MEX.
Congenital hydrocephalus is a recessive genetic abnormal condition affecting Friesian horses, so the identification of healthy carrier animals is crucial to avoid inheriting such condition. Therefore, the objective of the present study was the detection of the B3GALNT2 gene mutation related to the presence of hydrocephalus, through the rhAmp SNP technique to identify healthy carrier horses. The study was performed in 4 locations in southern Sonora, Mexico. Blood samples were collected from 51 Friesian horses using EDTA tubes, which were centrifuged until the leuko-platelet layer was obtained. Subsequently, the TACOTM DNA extraction kit was used to obtain the DNA, which was processed by the rhAmp SNP assay to detect the mutation in the B3GALNT2 gene. A total of 7 (13.72 %) Friesian horses were found to be heterozygous carriers (C/T). In conclusion, the presence of the mutant allele was confirmed by the rhAmp SNP assay, which was proposed as an effective molecular technique for the detection of horses as carriers of genetic abnormal conditions.
La hidrocefalia congénita es una condición genética recesiva anormal que afecta a los caballos Friesian, por lo que la iden- tificación de animales portadores sanos es crucial para evitar heredar dicha condición. Por ello, el objetivo del presente estudio fue la detección de la mutación en el gen B3GALNT2 relacionada con la presencia de hidrocefalia mediante la técnica de rhAmp SNP para identificar caballos portadores sanos. El estudio se realizó en 4 localidades del sur de Sonora, México. Se tomaron muestras de sangre de 51 caballos Frie- sian utilizando tubos con EDTA, los cuales fueron centrifuga- dos hasta obtener la capa leuco-plaquetaria. Posteriormente, se utilizó el kit de extracción de ADN TACOTM para obtener el ADN, el cual fue procesado mediante el ensayo rhAmp SNP para detectar la mutación en el gen B3GALNT2. Un total de 7 (13.72 %) caballos Friesian resultaron ser portadores hete- rocigotos (C/T). En conclusión, se confirmó la presencia del
*Author for correspondence: Pablo Luna-Nevárez1 e-mail: pluna@itson.edu.mx
Received: March 2, 2024
Accepted: December 3, 2024
Published: January 22, 2025
alelo mutante mediante el ensayo rhAmp SNP, el cual es pro- puesto como una técnica molecular eficaz para la detección de caballos portadores de anomalías genéticas.
The Friesian horse breed, originated in the Netherlands, was registered in 1879 and currently has a large active breeding population. History shows that this population was smaller, causing an accumulation of inbreeding and a decrease in genetic diversity, resulting in a high incidence of genetic defects that exceed the 1% inbreeding rate indicated by the FAO. All equine breeds have a different genetic variety, but that with the least genetic diversity is the Friesian breed, which is characterized by having a small population with an uneven genetic contribution of ancestry (Ducro et al., 2015). In recent years, the horse industry in Mexico has shown annual growth rates of 10 % with more than 150 horses bre- eding establishments, making Mexico the second country with the largest number of horses in the world, despite their minor genetic divergence. In 2000 arrived the first Friesian called “Theet van de Pluum” and currently it has been esti- mated that there are around 7000 horses registered in the Mexican Friesian Horse Association (Asociación Mexicana del
Caballo Frisón, 2020).
One of the most important hereditary pathologies observed in horses is the congenital hydrocephalus, a birth defect that results in a significant and harmful increase in the volume of the cranial cavity due to the accumulation of cere- brospinal fluid in the brain’s ventricles (Ojala and Ala-Huikku, 1992). Such disease is associated with a single nucleotide substitution from cytosine to thymine (XM_001491545 c.1423C > T) in the b-1,3-N-acetylgalactosaminyltransferase 2 (B3GALNT2) gene, and it has been reported in several breeds such as Quarter Horse, American Miniature Horse, Friesian Horse, Standarbred, Hanoverian Warmblood and Thoroughbred (Foreman et al., 1983; Ojala and Ala-Huikku, 1992; Ferris et al., 2011; Oey et al., 2011; Sipma et al., 2013).
Congenital hydrocephalus is an uncommon genetic defect that in the last 30 years has presented an increase in
Volume XXVII
DOI: 10.18633/biotecnia.v27.2276
reports in Friesian horses, compared to other breeds, due to their low genetic diversity (Ayala-Valdovinos et al., 2017). Cu- rrently, an effective treatment to cure equine hereditary hy- drocephalus is not available; then, it is necessary to continue working on the evaluation of the inheritance of hydrocepha- lus through different genetic tests, to avoid the reproduction of animals affected with this mutation (Finno, 2020).
Since hydrocephalus in Friesian horses is an autosomal recessive hereditary disease, the method of choice to identify and prevent this disease is molecular testing, which allows the detection of animals heterozygous for the mutation in the B3GALNT2 gene associated with hydrocephalus (Ayala- Valdovinos et al., 2017). Results of this technique enable the identification of unaffected carrier animals, facilitating their exclusion from reproductive programs, and thus, reducing the incidence of hydrocephalus in the population (Ducro et al., 2015). The rhAmp SNP assay, an enzymatic system with the best allele specificity, uses RNasa H2 to eliminates or reduces the presence of dimers, and generates a higher fluorescence than other genotyping techniques resulting in better clustering and separation of genotypes. Also, the use of universal reporter markers makes possible the multiplex genotyping of SNPs, achieving the simultaneous detection of two SNPs in a single PCR reaction, which reduces the cost of the assay and increases the yield (Beltz et al., 2018).
Therefore, the objective of the present study was the implementation of rhAmp SNP genotyping assay as a novel molecular technique, to detect the presence of alleles in the B3GALNT2 gene associated with congenital hydrocephalus in Friesian horses from southern Sonora, México.
All animal procedures performed in this study were revised and approved by the “Bioethics Committee from the Agro- nomic and Veterinary Sciences Department”, at the Instituto Tecnológico de Sonora (ITSON) located in Ciudad Obregón, Sonora, Mexico (Protocol code 2022_003).
The present study included a total of 51 Friesian horses (29 males and 22 females), 3 to 6 years old, and optimal body condition, randomly selected from 4 different farms. All the horses had a phenotype without hydrocephalus, since animals showing this disease die at birth. The collaborative farms were open equine stables located in Huatabampo, Na- vojoa, Cajeme and Hermosillo, which are municipalities in the southern of Sonora, Mexico, and geographically located bet- ween 32°29’ and 26°14’ North latitude and between 108°26’ and 105°02’ West longitude of the Greenwich Meridian.
A blood sample (4 mL) was collected from each horse by jugular vein puncture using BD Vacutainer® tubes with EDTA K2, which were identified and transported to the ITSON Vete-
rinary Laboratory. Blood samples were centrifuged for 40 min at 30,000 rpm to separate the leuko-platelet layer, which was transferred into 1.5 mL tubes, and homogenized by agitation and inversion. Afterward, the DNA extractions were carried out by the taco™ Nucleic Acid Automatic Extraction System (GeneReach Biotechnology Corp.) using the taco™ DNA/RNA Extraction Kit according to the manufacturer’s instructions. Both quality and quantity of DNA per sample were obtained with UV spectrophotometry (BioSpect-Nano, Shimadzu®). DNA integrity was verified by electrophoresis on a 1 % agaro- se gel stained with ethidium bromide using 90 V for 45 min. The gel was visualized in the system with ultraviolet light and recorded by BioDoc-It Imaging SystemTM (Analytik Jena US LLC, Upland, CA, USA). DNA extractions were placed in sterile vials, stored at -20 °C, and subsequently processed for mole- cular analyses with the rhAmp SNP assay.
To identify the single nucleotide variations with the cytosine to thymine (C/T) change position at the nucleotide 75,907,505 in the chromosome 1 Equus caballus (NC_009144.3) covering B3GALNT2 gene, the sequence was downloaded from the Ensembl database (https://www.ensembl.org/index.html) and then analyzed using the SnapGene Viewer program (https://www.snapgene.com).
Based on the previous information, two sequences of 250 bp were generated and the variation (C/T) was placed in the middle of the amplicon to be used as synthesized con- trols. Subsequently, from the already selected sequences, the primers and probes for mutation detections were designed using the Integrated DNA Technologies software (i.e., rhAmp SNP genotyping section), in which the fluorophore FAM was assigned for the reference allele and the fluorophore VIC for the alternative allele.
To develop the rhAmp SNP reaction, gBlocks were used as synthetic controls, with the normal equine sequence and a synthetic positive with the mutant allele. These components were activated in 50 µL nuclease-free water and diluted from a concentration of 101 to 103 ng/µL, following the protocol proposed by Integrated DNA Technologies (https://www. idtdna.com). The volumes of reagents used for the rhAmp SNP reaction were 2.65 µL of combined master mix and reporter mix, 0.25 µL of rhAmp SNP assay (20X), 0.10 µL of nuclease-free water, and 2 µL of DNA at a concentration of 10 ng/µL.
Reactions were then carried out with different concen- tration gradients of controls until triplicates were obtained to select the most suitable concentration for the rhAmp SNP technique. This technique was performed on the Bio-Rad CFX96TM real-time thermal cycler (Bio-Rad Lab Inc., Hercules CA, USA) using FAM and VIC fluorophores, with an amplifica- tion program of 1 initial cycle of enzyme activation at 95 °C for 10 min, followed by 39 cycles of denaturation extension at 95 °C for 10 sec, 60 °C for 30 sec and 68 °C for 20 sec.
Results of the allele discrimination process were inter- preted as follows: Homozygous allele 1 (C/C) lies along the horizontal axis (high FAM and low VIC); homozygous allele 2 (T/T) is expected to be parallel with the vertical axis (high VIC and low FAM signal). Finally, heterozygote alleles (C/T) are expected to cluster along the diagonal, centrally in the graphic (nearly equal FAM and VIC signals).
The sample size was determined by a simple completely ran- dom sampling using the formula described by Schaeffer et al. (1996), and limit on the estimation error of less than 5 % (P < 0.05). The frequency of carrier animals was determined as the proportion of heterozygous animals with respect to the total number of sampled animals.
The DNA evaluated by spectrophotometry showed an ave- rage OD 260/280 of 1.95 and a concentration of 184.75 ng/ µL. The purity of the nucleic acids was based on the optical
GAATGTTGTCTTCCCCGT AATGTTGTCTTCCCCGC
CGCTTACTATTAGACTCACATTCACG
Specific primer 1
Specific primer 2 Reverse primer
Sequence 5’ 3’
Primer
Table 1. Sequences of primers used to perform the rhAmp SNP technique. Tabla 1. Secuencias de los iniciadores usados para realizar la técnica de rhAmp SNP.
density (OD) indicator, obtaining values from 1.8 to 1.9 in the 260/280 ratio. According to the National DNA Bank, a 260/280 ratio is very stable, and values between 1.8 and 2.0 are required to consider that the DNA is optimal for the geno- typing assay. Therefore, the purity of the samples processed in the current study were optimal for performing the rhAmp SNP technique.
According to Cornejo et al. (2014), the magnetic bead kit (TACOTM DNA kit) used for the nucleic acid extraction procedures adsorbs negatively charged DNA onto a selective matrix. The DNA is held together during the removal of ce- llular remnant, whereas secondary metabolites are removed by lysis and washing solutions to release the molecule from the matrix. This method decreases the extraction time by reducing steps in the procedure and guarantees a high ex- traction purity, then DNA recovery and contaminant removal processes are very efficient.
To confirm that the samples analyzed had a high mole- cular weight and to verify that they can be conserved in the long term, an agarose gel electrophoresis was performed and bands with intensity were obtained after reading (Figure 1). The results of the electrophoresis agreed with the description made by Cornejo et al. (2014). They explained that when the DNA is intact, a well-defined band should be observed close to the well where the sample is placed, on the other hand, when a band presents sweeping or the lane is luminous, it is indicative of a degraded or fragmented DNA product.
Figure 1. DNA extraction on 1.5 % agarose gel stained with ethidium bromide. Lanes 1 to 8 contain DNA products from blood samples of Friesian horses.
Figura 1. Extracción de ADN en gel de agarosa al 1.5 % teñido con bromuro de etidio. Los carriles del 1 al 8 contienen los productos de ADN a partir de muestras sanguíneas de caballos Friesian.
The standardization of the rhAmp SNP technique was per- formed with the gBlocks, which were designed to visualize the allelic discrimination plot. The gBlocks gene fragments are double-stranded, sequence-verified genomic blocks up to 500 base pairs. At the end of the process, the ideal concen- tration of the gBlocks for the reaction was 105 and the final volume per sample was 5 µL. The results after standardiza- tion showed both controls and synthetic positive samples (Figure 2).
Figure 2. Graph of standardization of rhAmp SNP genotyping directed to amplicons with synthetic alleles, with reference allele C and alternative allele
T. Post-PCR read data were obtained and the normalized reporter signal was measured in Relative Fluorescence Units (RFU) for allele 1 (FAM) and allele 2 (Yakima Yellow alternative of VIC) along the X-Y axes respectively. The allelic discrimination showed three distinct genotype groups, including homozygous reference allele C/C (yellow), heterozygous C/T (green) and homozygous alternative allele T/T (blue).
Figure 2. Gráfica de estandarización de genotipado rhAmp SNP dirigido a amplicones con alelos sintéticos, con alelo de referencia C y alelo alternativo
T. Se obtuvieron datos de lectura post-PCR y se midió la señal reportera normalizada en Unidades Relativas de Fluorescencia (RFU) para el alelo 1 (FAM) y el alelo 2 (Yakima Yellow alternativo de VIC) a lo largo de los ejes X-Y respectivamente. La discriminación alélica mostró tres grupos de genotipos distintos, incluyendo homocigoto alelo de referencia C/C (amarillo), heterocigoto C/T (verde) y homocigoto alelo alternativo T/T (azul).
According to Aragón-López et al. (2021), an increase in the use of gBlocks has been reported recently in different investigations, which has been used to achieve standar- dization in less time. Therefore, the use of these fragments for standardization in rhAmp SNP is recommended for an efficient detection and real comparison, in case of not having a homozygous recessive individual.
The rhAmp SNP genotyping was performed through the allelic discrimination technique (Figure 3) and using Bio-Rad CFX96TM software to identify the presence of the B3GALNT2 gene mutation. In the rhAmp SNP assay, the biallelic discrimi- nation process is achieved by the competitive binding of two allele-specific forward primers, one labelled with fluoropho- re Yakima yellow dye (YY) alternative to fluorophore Victory (VIC), and the other with fluorescein amidite (FAM) (Giglioti et al., 2020). This technology uses a unique two-enzyme system coupled with RNA-DNA hybrid primers to interrogate target SNPs.
Figure 3. Graph of allelic discrimination results of rhAmp SNP genotyping with the reference allele amplicon C and alternative allele T (XM_001491545) using horse biological samples. Post-PCR read data showed quantification of signals to identify RFU along the X-Y axes respectively for allele 1 (FAM) and allele 2 (Yakima Yellow alternative of VIC). This assay used 51 DNA samples extracted from Friesian horses.
Figure 3. Gráfica de resultados de discriminación alélica de genotipado rhAmp SNP con el amplicón del alelo de referencia C y alelo alternativo T (XM_001491545) utilizando muestras biológicas de caballo. Los datos de lectura post-PCR mostraron la cuantificación de señales para identificar las RFU a lo largo de los ejes X-Y respectivamente para alelo 1 (FAM) y el alelo 2 (Yakima Yellow alternativo de VIC). En este ensayo se utilizaron 51 muestras de ADN extraídas a partir de caballos Friesian.
According to standardization of rhAmp SNP technique, the 51 horses were genotyped using the allele C as reference amplicon and the allele T as positive control, and a mixture of both to form the heterozygous control. The genotyping results revealed the presence of 7 heterozygous horses (1 female and 6 males) carrying the mutant allele (C/T) and 44 homozygous dominant horses (21 females and 23 males) with normal genotypes (C/C). Then, the estimated frequency of the mutant allele was 13.72 % (7/51x100). In an autoso- mal recessive condition, the heterozygote horses have one normal allele and one mutated allele; they do not show the disease because the normal allele is sufficient to produce the functional protein codified by the gene B3GALNT2. However, in some cases, there could be subtle variations in the function of such protein but not sufficient to manifest the disease.
The incidence found in this study was higher than the
9.6 % reported by Ayala-Valdovinos et al. (2017) and lower than the 17.3 % reported by Ducro et al. (2015). Kolb and Klein (2019) reported the first case of congenital hydrocepha- lus associated with a nonsense mutation of the B3GALNT2 gene in Belgian draft horses. The authors emphasized the im- portance of genotyping testing to identify carriers’ animals in different horse breeds as potential tool to study congenital diseases.
Additional research involving a larger population size of Friesian horses is expected to find a higher frequency of
heterozygous carrier individuals in the state of Sonora. The detection of individuals carrying the B3GALNT2 gene muta- tion is a relevant indicator, considering that the frequency of the mutant allele is higher than 1 % in the population under study. Because of this, in this population the mutant allele will likely be inherited most frequently causing the conse- quent appearance of homozygous recessive animals, which will manifest the condition of hydrocephalus. According to Mendel’s laws, the mating of two carrier animals has a 25 % chance of producing a diseased offspring. This would have serious economic repercussions for producers in the state of Sonora.
The rhAmp SNP technique use RNase H2, that eliminates or significantly reduces the presence of dimers, which com- plemented with the use of universal indicators, make possible the multiplex genotyping of SNPs, achieving simultaneous detection of two SNPs in a single PCR reaction, reducing the cost of the assay and increasing throughput (Beltz et al., 2018; Broccanello et al., 2018).
According to the results obtained in the current study, the rhAmp SNP technique demonstrated efficacy and high specificity, the reaction time was shorter compared to other reported techniques, and the results of all samples were ob- tained in a single graph. Additionally, this technique reduced the use of reagents by containing in a single mixture (Mix), which is necessary to perform the reaction. It suggests that the rhAmp SNP technique showed certain advantages over other molecular techniques that position it as one of the techniques of choice for the genotyping of mutant genes.
The rhAmp SNP technique demonstrated its efficacy and sen- sitivity through the successful identification of the mutation in the B3GALNT2 gene in Friesian horses in Sonora. The results obtained demonstrated the relevance of this molecular assay for the diagnosis of genetic mutations, which allowed diffe- rentiating carrier animals from non-carriers. This is of crucial importance in the case of congenital hydrocephalus because finding animals carrying the mutation mean that there is a risk of the birth of offspring with hydrocephalus, which will generate great economic losses for the horse breeders.
We thank Dr. Alejandro M. Figueroa for providing the equi- pment used to perform the molecular tests, as well as MVZ Kintcya Pacheco for helping in blood sampling. We also appreciate staff of the cooperative horse farms, and the stu- dents involved in this project.
The authors declare that there are no conflicts of interest associated with the current study.
Aragón-López, C., Luna-Nevárez, P., Ortiz-Encinas, V., Leyva- Corona, J., Cantú-Soto, E. and Reyna-Granados, J. 2021. Detección molecular de Ehrlichia canis, Anaplasma platys y Rickettsia rickettsii en caninos domésticos del municipio de Cajeme, Sonora, México. Abanico Veterinario. 11:1-15. http://dx.doi.org/10.21929/abavet2021.45
Asociación Mexicana del Caballo Frisón. 2020. Historia del caballo frisón en México. AMCAF. Recovered from: https:// amcaf.com.mx/caballo-frison.html
Ayala-Valdovinos, M.A., Galindo-García, J. and Sánchez- Chiprés, D. 2017. Genotyping of friesian horses to detect a hydrocephalus-associated c.1423C>T mutation in B3GALNT2 using PCR-RFLP and PCR-PIRA methods: Frequency in stallion horses in México. Molecular Cell Probes. 32:69.71. https://doi.org/10.1016/j.mcp.2016.12.005
Beltz, K., Tsang, D., Wang, J., Rose, S., Bao, Y., Wang, Y., Larkin, K., Rupp, S., Schrepfer, D., Datta, K., Gunderson, K., Sailor, C., Hansen, S., Dobosy, J., Lewis, L., Menezes, A., Walder, J., Behlke, M. and Chen, C. 2018. A high-performing and cost- effective SNP genotyping method using rhPCR and universal reporters. Advances in Bioscience and Biotechnology. 9;497-
Broccanello, C., Chiodi, C., Funk, A., McGrath, J.M., Panella, L. and Stevanato, P. 2018. Comparison of three PCR-based assays for SNP genotyping in plants. Plant Methods. 28;14:28. https://doi.org/10.1186/s13007-018-0295-6
Cárdenas, Y. 2018. Determinación de la contaminación microbiológica del agua de riego aplicando nuevas estrategias de análisis. [Tesis de doctorado]. Universidad de Barcelona. Departamento de Genética, Microbiologia Estadística. http://hdl.handle.net/2445/123509
Cornejo, A., Serrato, A., Rendón, B. and Rocha, M. 2014. Herramientas moleculares aplicadas en ecología: Aspectos teóricos y prácticos. 1ra ed. México, D.F. Instituto Nacional de Ecología y Cambio Climático. ISBN: 978-607-8246-72-4
Ducro, B., Schurink, A., Bastiaansen, J., Boegheim, I., Steenbeek, F., Vos-Loohuis, M., Nijman, I., Monroe, G., Hellinga, I., Dibbits, B., Back, W. and Leegwater, P. 2015. A nonsense mutation in B3GALNT2 is concordant with hydrocephalus in Friesian horses. BMC Genomics. 16, 761. https://doi.org/10.1186/ s12864-015-1936-z
Foreman, J.H., Reed, S.M., Rantanen, N.W., DeBowes, R.M. and Wagner, P.C. 1983. Congenital internal hydrocephalus in a quarter horse foal. Journal of Equine Veterinary Science. 3:154-164. https://doi.org/10.1016/S0737-0806(83)80036-7
Ferris, R.A., Sonnis, J., Webb, B., Lindholm, A. and Hassel, D. 2011. Hydrocephalus in an American miniature horse foal: A case report and review. Journal of Equine Veterinary Science. 31:611-614. https://doi.org/10.1016/j.jevs.2011.03.005
Finno, C. 2020. Equine genetic diseases (An issue of Veterinary Clinic, Equine Practice). 1ra ed. Philadelphia, Pennsylvania: Elsevier Inc. ISBN: 978-032-370-859-3.
Giglioti, R., Gutmanis, G., Katiki, L.M., Okino, C.H., de Sena Oliveira, M.C. and Vercesi Filho, A.E. 2020. New high-sensitive rhAmp method for A1 allele detection in A2 milk samples. Food Chemistry. 30:313:126167. https://doi.org/10.1016/j. foodchem.2020.126167
Kolb, D.S. and Klein, C. 2019. Congenital hydrocephalus in a Belgian draft horse associated with a nonsense mutation in B3GALNT2. Canadian Veterinary Journal. 60(2):197-198. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6340252/
Oey, L., Müller, J.M., von Klopmann, T., Jacobsen, B., Beineke,
A. and Feige, K. 2011. Diagnosis of internal and external hydrocephalus in a warmblood foal using magnetic resonance imaging. Tierarztliche Praxis Ausgabe G, Grosstiere/Nutztiere. 39:41-45. 10.1055/s-0038-1624609
Ojala, M. and Ala-Huikku, J. 1992. Inheritance of hydrocephalus in horses. Equine Veterinary Journal. 24:140-143. 10.1111/ j.2042-3306.1992.tb02799.x
Scheaffer, R.L., Mendenhall W. and Ott, R.L. 1996. Elementary Survey Sampling. 5th Edition, Duxbury Press, New York.
Sipma, K.D., Cornillie, P., Saulez, M.N., Stout, T.A., Voorhout, G. and Back, W. 2013. Phenotypic characteristics of hydrocephalus in stillborn Friesian foals. Veterinary Pathology. 50:1037- 1042. https://doi.org/10.1177/0300985813488955