Journal of biological and health sciences http://biotecnia.unison.mx
Universidad de Sonora
ISSN: 1665-1456
Original Article
1 Universidad de Sonora. Departamento de Investigaciones Científicas y Tecnológicas. Ave. Colosio s/n, entre Reforma y Sahuaripa, Col Centro. Hermosillo, Sonora, México 83000.
2 Distribuidor Oficial en Química Bengala S.A de C.V. Lauro de Uranga No 2013. Col San Miguel De Huentitán. Guadalajara, Jalisco. 44300.
Efecto de los extractos herbales comerciales Tetrayou® y Feed Ad® sobre la supervivencia del camarón blanco del Pacífico, Penaeus vannamei, expuesto a una cepa patogénica de Vibrio parahaemolyticus-AHPND
Herbal remedy is one of the most important eco-friendly stra- tegies because of its content of natural bioactive compounds that can act against bacterial diseases. In the present study, organisms of P. vannamei were challenged with a strain of V. parahaemolyticus-AHPND. A simple experimental design was performed to compare the survival rate among five different commercial herbal extracts concentrations of Tetrayou® and Feed Ad® against a control treatment. Gross observation and histopathology were carried out on moribund organisms. Significant differences were observed (p < 0.05) where orga- nisms fed with T5, which contained a combination of Tetra- you® and Feed Ad® at a concentration of 400 mg Tetrayou®/ kg of commercial feed + 1g Feed Ad®/kg of commercial feed, showed the highest survival value (73 ± 5.8 %) in comparison to the rest of experimental treatments. Gross observation showed the characteristic signs of AHPND which were sup- ported by histopathological analysis. It is concluded that, although Tetrayou® and Feed Ad® are suitable products to control the mortality caused by AHPND, it is recommended to use them in combination during a minimum feeding pe- riod of six weeks as a prophylactic agent.
Una de las estrategias ecológicamente amigables para el tratamiento de enfermedades en acuacultura es la utilización de los compuestos herbales debido a su gran contenido de compuestos bioactivos con efecto antimicrobiano. En este estudio, se evaluó la supervivencia de P. vannamei ante una cepa de V. parhaemolyticus-AHPND. Se llevó a cabo un diseño experimental simple para comparar la tasa de supervivencia de los organismos de P. vannamei alimentados con cinco dife- rentes concentraciones de los productos herbales Tetrayou® y Feed Ad® contra un control. Adicionalmente, se realizaron
*Author for correspondence: Christian Minjarez-Osorio e-mail: christian.minjarez@unison.mx
Received: November 24, 2024
Accepted: January 29, 2025
Published: March 13, 2025
análisis en fresco, así como histopatología. Al final del ex- perimento, se observaron diferencias significativas (p<0.05) donde el tratamiento T5, el cual contenía una combinación de ambos productos a una concentración de 400 mg Tetra- you®/kg de alimento + 1g Feed Ad®/kg de alimento, mostró el mayor valor de supervivencia (73 ± 5.8 %). La observación en fresco mostró el daño característico de AHPND, los cuales fueron respaldados por histopatología. Se concluye que, si bien Tetrayou® y Feed Ad® son productos efectivos que pue- den ser utilizados para combatir la mortalidad causada por AHPND, se recomienda utilizarlos en combinación durante un periodo de al menos seis semanas como agente profilác- tico.
Acute hepatopancreatic necrosis disease (AHPND), formerly known as early mortality syndrome (EMS) (Lightner et al., 2012), is probably the most critical shrimp disease in Mexico and Asian countries (Shinn et al., 2018; Soto-Rodriguez et al., 2018), reaching losses up to US$44 billion between 2010 and 2016 in China, Malaysia, Mexico, Thailand, and Vietnam (Tang and Bondad-Reantaso, 2019). The first AHPND outbreak was reported in China in 2009, and subsequently countries such as Mexico, Thailand, Malaysia, Vietnam, the Philippines, Bangladesh, and the USA, have reported outbreaks of the disease, causing a significant reduction of shrimp production in these countries (Nunan et al., 2014; Eshik et al., 2017; Dhar et al., 2019; Muthukrishnan et al., 2019; Peña-Navarro et al., 2020).
In 2013, the causative agent of AHPND was identified as
V. parahaemolyticus, which is considered as a ubiquitous and opportunistic marine bacterium (Tran et al., 2013). Additio- nally, all AHPND-causing strains of V. parahaemolyticus carry a large plasmid which is absent in non-AHPND strains (Han
Volume XXVII
DOI: 10.18633/biotecnia.v27.2518
et al., 2015b; Sirikharin et al., 2015). This plasmid contains the pirA and pirB genes that encode for binary toxins named Pir A and Pir B in V. parahaemolyticus, which are the main virulence factor of the AHPND (Kondo et al., 2014; Han et al., 2015a). Nowadays, it is known that V. parahaemolyticus is not the only species that carries the plasmid-AHPND, but there are some other species such as Vibrio campbellii (Han et al., 2017), Vibrio harveyi (Kondo et al., 2015), Vibrio owensii (Liu et al., 2018) and Vibrio punensis (Restrepo et al., 2018) that may carry it, and consequently cause AHPND (Aranguren-Caro et al., 2020).
Organisms affected by AHPND show visible clinical signs that includes slow growth, anorexia, erratic swimming, mela- nized spot in the hepatopancreas, lethargy, atrophied pale to white hepatopancreas, empty gastrointestinal tract, red appendages, and soft shells (Tran et al., 2013; Soto-Rodriguez et al., 2015). Additionally, histological analysis of hepatopan- creas collected from infected organisms reveals sloughing of tubule epithelial cells in the early stage of AHPND, while in la- ter stages of infection necrosis of the tubular epithelium and infiltration of the hemocytes are observed (Soto-Rodriguez et al., 2015; Kumar et al., 2020).
On the other hand, shrimp farmers have been and still are using antibiotics to control bacterial diseases. Neverthe- less, due to the potential adverse effect on human health, the utilization of antibiotics in aquaculture has been restricted or even banned in many countries (Lulijwa et al., 2019). Morever, the frequent use of antibiotics in aquaculture has led to the emergence of multiple antibiotic-resistant strains, making antibiotics ineffective against bacterial infections (Sivasankar et al., 2017; Zago et al., 2020; Loo et al., 2020).
Herbal remedy is one of the most important eco-friendly strategies to substitute the use of antibiotics (Citarasu et al., 2022), since herbal medicine contains bioactive compounds like flavonoids, pigments, steroids, tannins, glycosides, terpe- noids and essential oils, that promote a variety of beneficial effects including antimicrobial properties and resistance to disease (Citarasu et al., 2002; Citarasu et al., 2010; Citarasu et al., 2022). Tetrayou® and Fed Ad® are both commercial herbal blends that are mainly used as a prophylactic product in livestock industry in Northwest Mexico, which utilization may be a suitable option to be extended to shrimp culture. Therefore, the present study aimed to evaluate the effect of two commercial herbal blends Tetrayou® and Feed Ad® on the survival of P. vannamei challenged with a pathogenic strain of V. parahaemolyticus-AHPND.
A total of 210 organisms of P. vannamei with a mean weight of 12 g were collected from experimental ponds of University of Sonora located at Kino Bay Experimental Station, Kino Bay, Sonora, Mexico. Organisms were transported alive with con- tinuous aeration to the Aquaculture Laboratory of University of Sonora in Hermosillo, Sonora. Upon arrival, organisms were stocked randomly in seven 250-L tanks, at a density
of 30 organisms per tank. Organisms were fed with a com- mercial feed with 35 % of protein for one week. A composed sample of 15 organisms was taken to be analyzed by PCR to make sure that organisms were not previously infected with
V. parahamolyticus.
Herbal products feeding trial and daily maintenance After acclimatization, organisms stocked in tanks from 1 to 5 began to be fed with commercial pellets previously impreg- nated with herbal commercial products Tetrayou® and Feed Ad® at different concentrations (Table 1) (using molasses as binder), and subsequently dried at room temperature (25 oC) during 24 h. Additionality, organisms contained in tanks 6 and 7 were fed with commercial diet (non-herbal products added) as control. Organisms were fed for 42 days based on 3
% of its body weight, dividing the daily ration into four equal feedings provided at 08:00, 12:00, 16:00 and 20:00 h. Daily maintenance also included cleaning and siphoning the re- maining uneaten feeds and feces out of the tanks. Dissolved oxygen (D.O.) was maintained above 6.0 mg L− 1 throughout the experiment while water temperature and pH were main- tained at 27.5 °C ± 1.4 °C and 7.7 ± 0.1, respectively.
The pathogenic strain of V. parahaemolyticus-AHPND used in the present study was isolated from moribounds white shrimps, P. vannamei cultured in Sonora, Mexico during a mortality event with visible signs of AHPND infection. The bacteria was subsequently verified as possessing the pirA and pirB genes, which are responsible for causing AHPND (Han et al., 2015b; Sirikharin et al., 2015). The V. parahaemolyticus- AHPND strain was cultured on tryptic soy agar (TSA) medium added with 2.5 % sodium chloride during 24 h at 30 oC, and from this plate, another six plates were cultured on TSA under the same conditions. Bacteria biomass produced in plates were washed and collected in a 2-L flask using a 2.5 % sterile saline solution and filled with saline solution to reach a final volume of 1.5 L. Inoculum concentration was determined by turbidimetry using a microplate and solution was read at 550 nm (Alvárez-Cirerol et al., 2019).
Inmediatelly after the feeding trial, a challenge test of P. vannamei with V. parahaemolyticus-AHPND was performed in containers with a 10 L capacity filled with 7 L of seawater, previously filtered, and sterilized. As shown in Table 1, an experimental design consisting of five herbal treatments at different concentrations (containers 1 to 5), a positive control which contained the pathogen (container 6), and a negative control without pathogen (not included in statistical analysis) (container 7) was carried out. All treatments were performed in triplicate (21 containers). A total of 10 organisms taken from feeding treatments (Tetrayou®, Feed Ad®, and com- mercial diet with non-herbal products added), as explained above, were washed thrice by immersion in sterile seawater
Table 1. Concentration of Tetrayou® and Feed Ad® added (per kg of commercial feed) to each experimental treatment.
Tabla 1. Concentración de Tetrayou® y Feed Ad® adicionada (por kg de alimento comercial) a cada tratamiento experimental.
Experimental treatment | Tetrayou® mg/kg of commercial feed | Feed Ad® g/kg of commercial feed |
T1 | 300 | 0 |
T2 | 400 | 0 |
T3 | 500 | 0 |
T4 | 300 | 1 |
T5 | 400 | 1 |
T6 (Positive Control) | 0 | 0 |
T7 (Negative Control) | 0 | 0 |
to reduce surface bacteria and stocked in each container (30 organisms per treatment). Each experimental container was added with 60 mL of bacterial inoculum, which correspon- ded to 6x104 CFU/mL of V.parahaemolyticus-AHPND. During the bioassay, mortality was recorded daily; moribund and dead organisms were removed. Experiment lasted seven days and the remaining organisms were sacrificed to carry out histological and molecular analysis.
Prior the histological analysis, a meticulously gross examina- tion of remaining organisms was performed. Subsequently, hepatopancreas of 15 organisms per treatment was carefully excised and stored at -20 oC to perform molecular analysis, while a tissue sample was preserved in Davidson’s fixative for 48 h before processing by routine histology. The tissue sections were stained with the Hematoxylin-Eosin technique (H&E). Gross observation and histological interpretation were based on de Souza-Valente and Whan (2021) and Le Nguyen et al. (2023).
V. parahaemolitycus confirmation
To confirm V. parahaemolyticus infection by the PCR procedu- re, 20 mg of hepatopancreas were obtained from two orga- nisms of each treatment for genomic DNA (gDNA) extraction, using the QIAamp tissue mini kit (Qiagen, Westburg b.v., The Netherlands) according to the manufacturer’s protocol. For PCR assay, each PCR reaction contained 0.2 μM of each oligo (forward and reverse), 7.5 μL of Crystal Master mix (Jena Bios- cience), 6.1 μL of nuclease-free water and 100 ng of gDNA. To detect V. parahemolyticus in organisms, oligos were used for the V. parahemolyticus thermolabile hemolysin (TLH) en- coding gen: tlF (5′ AAAGCGGATTATGCAGAAGCACTG 3′) and tlR (5′ GTCACTTTCTAGCATTTTCTCTGC 3′) targeting a 450 bp amplicon (Taniguchi et al., 1985, 1986; Ward and Bej, 2006). The amplification conditions were as follows: 95 °C for 3 min, followed by 30 cycles at 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min; and a final step at 72 °C for 6 min. In addition, to detect pirA and pirB genes of V. parahaemolyticus in the bacterial culture, primers used were PIRF: 5’ TGACTATTCAC- GATTGGACTG 3’ and AP4R1: 5’ CACGACTAGCCATTGTTA 3’ for pirA, and PIRF2: 5’ TGATGAAGTGATGGGTGCTC 3’ and PIRR2:
5’TGTAAGCGCCGTTTAACTCA 3’for pirB (Han et al., 2015b). The
cycling reactions were conducted at 95 °C for 5 min, followed by 30 cycles at 94 °C for 30 sec, at 54 °C for 30 sec and 72 °C for 60 sec, plus a final extension at 72 °C for 10 min. Amplified PCR products (5 μL) were verified by electrophoresis using
1.5 % agarose gels in 1× TAE buffer stained with GelRed, and visualized under UV transillumination and documented by a digital photography system (DNR minibis pro).
PirA and PirB confirmation
PCR analysis of bacteria used to infect the organisms in the present experiment revealed a 450 bp band (Fig. 1A), this gene encodes for the TLH, which is considered as a signature molecular for V. parahaemolyticus. Additionally, PCR analysis to detect pirA and pirB genes revealed a pair of bands of ~ 300 bp and ~400 bp (Fig. 1B) respectively, all bands were sequenced (data not shown). Therefore, molecular analysis confirmed that the bacteria used in the present experiment was a causative-AHPND strain of V. parahaemolyticus.
Survival rate (%) was subjected to one-way analysis of varian- ce and Duncan’s multiple range test for comparison of means (P < 0.05) using the XLSTAT software package. All percentage data were arcsine-transformed prior to analysis.
At the end of the challenge, the highest survival value (73
± 5.8 %) was observed in treatment T5 and the lowest in treatment T6 where 100 % mortality was registered (Fig. 2). Additionally, all survival rates where P. vannamei was fed with commercial herbal-extracts Tetrayou® and Feed Ad® were statistically higher (p<0.05) in comparison to those fed with treatment T6 (positive control-non-herbal products added), except when it was compared with treatment T2 (17 ± 11.5
%) where no significant differences were found (Fig. 2). It is evident that survival rate for treatment T2 did not behave as expected, since mortality in this treatment showed high values compared to other treatments where herbal extracts were evaluated. One possible explanation for this is that lixiviation may have occurred, since Tetrayou® and Feed Ad® herbal extracts utilized in the present study were bound by impregnation utilizing molasses and water. It is known that in aquafeeds preparation, it is crucial to supply the whole amount of nutrients and additives (Volpe et al., 2012). In this regard, to reduce lixiviation and enhance the stability of herbal products in water, other methods of binding must be explored. Pelleting is considered the most common thermal processing method in the production of animal feed. This method consists in agglomerating smaller feed particles by the use of mechanical pressure, moisture and heat (Abdollahi et al., 2013). Mišljenović et al. (2016) evaluated the effects of sugar beet molasses on pellet quality, concluding that mo- lasses as a binder is effective when pelleting is performed at certain temperature. Therefore, adding herbal products
Figure 1. PCR detection of the thermolabile hemolysin (TLH), pirA and pirB genes, from V. parahaemolyticus used in the bioassay.
Detection of the TLH gene from V. parahaemolyticus. M. Low Range (Jena Bioscience). Lines 1-6 TLH detection in organisms of experimental treatments. Line 7 negative control. Line 8 V. parahaemolyticus gDNA bacterial culture used in the bioassay. B. PCR assay targeting toxigenic genes pirA and pirB in V. parahaemolyticus. Lane (-) negative control.
Figura 1. Detección por PCR del gen de la hemolisina termolábil (TLH), y de los genes pirA y pirB de V. parahaemolyticus utilizados en el bioensayo. A. Detección del gen TLH de V. parahaemolyticus. M. Low Range (Jena Bioscience). Líneas 1-6 detección de TLH en organismos de los tratamientos experimentales. Línea 7 control negativo. Línea 8 cultivo bacteriano de ADN genómico de V. parahaemolyticus utilizado en el bioensayo. B. Ensayo PCR especificos a los genes toxigénicos pirA y pirB en V. parahaemolyticus. Línea (-) control negativo.
through pelletizing method may be a suitable option to re- duce lixiviation. However, caution should be taken, since it is reported that bioactive compounds found in herbal products responsible for their beneficial effects on shrimps, including resistance to disease, anti-stress, appetite stimulant, immu- nostimulation and antimicrobial properties (Citarasu, 2022), may be altered when exposed to high temperatures (Maurus et al., 2023).
In the present study, despite survival rate registered for
treatment T2, the rest of experimental treatments containing Tetrayou® and Feed Ad® showed higher survival values (ran- ging from 33 ± 15.3 % to 73 ± 5.8 %) compared to control treatment, suggesting that these herbal extracts contain bio- active compounds with a potent antimicrobial effect against
V. parahaemolitycus-AHPND. Similarly, several studies carried out under laboratory conditions have demonstrated the effectiveness of plant-based compounds against AHPND- causing strains of V. parahaemolyticus, either increasing sur- vival rate or enhancing the immunity response of shrimps. Maurus et al. (2023) determined that the extract of Scutellaria baicalensis at a concentration of 1 % enhances the resistance and survival rate of P. vannamei against V. parahaemolyticus- AHPND after four weeks of feeding the extract, while Nguyen et al. (2024) reported that the inclusion of Galla chinensis at 1 g/kg, not only promotes growth but also reduce P. vannamei mortality during V. parahaemolyticus infection. Linh et al. (2024) and Dewi et al. (2021) determined that Annona glabra and Psidium guajava leaf increase the immunity response
and resistance of P. vannamei against V. parahaemolyticus- AHPND infection.
Interestingly, Martínez-Aguilar et al. (2013) and Más et al. (2017) have reported that medicinal plants are more effective when they are used in blends with other plants than indivi- dually, since bioactive compounds found in different plants can act in synergy. In the present study, it was observed that the survival rate was higher in treatments where the herbal products Tetrayou® and Feed Ad® were used in combination (40-73 %), compared to treatments where Tetrayou® was evaluated alone (17-33 %) (Fig. 2). It is important to mention that, Tetrayou® and Feed Ad® are commercial blends manu- factured by the extraction of several plants known by their antiseptical properties, including Cuminum sp (Sharifi et al., 2021) and Cinnamomum sp. (Bandeira-Junior et al., 2022), which may act in synergy to control bacterial diseases, speci- fically against V. parahaemolyticus-AHPND as it was observed in the present study and as it is suggested by literature. Based on the promising results obtained against strains of
V. parahaemolyticus-AHPND under laboratory conditions, plant-based compounds seem to be a realistic option to substitute the use of antibiotics in aquaculture in the short- term. Therefore, in our view, future research must be focused on evaluating plant-based compounds in semi-commercial ponds, in order to evaluate how these herbal compounds be- have under variable conditions. It is worth mentioning that some studies have reported that results utilizing plant-based products may vary depending on certain factors (Maurus et
Figure 2. Survival of P. vannamei fed with different concentration of Tetrayou® and Feed Ad®. Data are means of 3 replicates ±
S.D. (Standard Deviation). Different letters indicate significant differences (Duncan’s alpha = 0.05). T7: Negative control without pathogen used as reference (not included in statistical analysis).
Figura 2. Supervivencia de P. vannamei fed alimentado con diferentes concentraciones de Tetrayou® y Feed Ad®. Los datos mostrados son resultados de triplicados ± D.S. (Desviación estándar). Letras diferentes indican diferencias significativas ((Duncan’s alpha=0.05). T7: control negativo sin patógeno utilizado sólo como referencia (no incluido en el análisis estadístico).
al., 2023) such as extraction method, exposure time, concen- tration and dosage applied, which also needs to be explored in future research.
On the other hand, visible signs and gross examination of moribund shrimps revealed lethargy, melanization, red appendages, pale body, sloughed hepatopancreas, and soft shells (Fig. 3). These findings are consistent with gross
observations reported by Tran et al. (2013) and Soto-Rodri- guez et al. (2015), as well as those documented in mortality events of P. vannamei caused by AHPND infection in Asia and Mexico (Nunan et al., 2014; Eshik et al., 2017; Dhar et al., 2019; Muthukrishnan et al., 2019; Peña-Navarro et al., 2020). Additionally, histological analysis of infected organisms supported previous gross observations revealing necrosis
Figure 3. Gross observation of P. vannamei. A-B. Healthy shrimp: (b) bright body, normal hepatopancreas (nh) and brown midguts (i). C-D. AHPND infected organisms: (m) melanization, (ra) red appendages, (p) pale body, (sh) sloughed hepatopancreas and (s) soft shell.
Figura 3. Observación en fresco de P. vannamei. A-B. Camarón sano: (b) cuerpo con brillo, hepatopáncreas con aspecto normal (nh) y vísceras marrón (i). C-D. organismos infectados con AHPND: (m) melanización, (ra) apéndices rojizos, (p) cuerpo pálido, (sh) desprendimiento del hepatopáncreas y
(s) cuerpo blando.
and severe disorganization of hepatopancreatic tissue due to the sloughing of tubular epithelium (Fig. 4), which is con- sidered a specific sign of AHPND infection (Soto-Rodriguez et al., 2015; Kumar et al., 2020). Therefore, based on the da- mage observed in hepatopancreatic tissue, organisms of P. vannamei infected in this study with a pathogenic strain of
V. parahaemolyticus-AHPND, were classified either in acute or terminal stage of AHPND infection based on de Souza- Valente and Whan (2021).
It is concluded that the combination of commercial plant-based extracts Tetrayou® and Feed Ad®, at a concentra- tion of 400 mg Tetrayou®/kg of commercial feed + 1g Feed Ad®/kg of commercial feed, is effective to be used not only as a prophylactic on P. vannamei, but to control the mortality
Figure 4. Histopathological examination of P. vannamei. A. non-infected organism: normal hepatopancreatic tissue configuration (nt). B. Acute- terminal stage of AHPND infection: necrosis (n) and severe hepatopancreatic tissue disorganization (td). Stained with hematoxylin-eosin. Scale bar: 200 µm.
Figura 4. Examinación histopatológica de P. vannamei. A. organismo no infectado: configuración normal del tejido hepatopáncreatico (nt).
Etapa aguda-terminal de la infección causada por AHPND: necrosis
(n) y desorganización severa del tejido hepatopáncreatico (td). Tinción hematoxilina-eosina. Escala: 200 µm.
caused by V. parahaemolitycus-AHPND after a minimum fee- ding period of six weeks. Finally, further studies are required to elucidate how these plant-based products interact with the immunology mechanisms of P. vannamei in order to enhance its efficiency when used to control AHPND.
The project was funded by the University of Sonora (project USO313008276).
The authors declare no conflict of interest.
Abdollahi, M.R., Ravindran, V. and Svihus, B. 2013. Pelleting of broiler diets: An overview with emphasis on pellet quality and nutritional value. Animal Feed Science and Technology. 179: 1-23.
Alvarez-Cirerol, F.J., López-Torres, M.A., Rodríguez-León, E., Rodríguez-Beas, C., Martínez-Higuera, A., Lara, H.H., Vergara, S., Arellano-Jimenez, M.J., Larios-Rodríguez, E., Martínez- Porchas, M., de-la-Re-Vega, E. and Iñiguez-Palomares,
R.A. 2019. Silver nanoparticles synthesized with Rumex hymenosepalus: A strategy to combat early mortality syndrome (EMS) in a cultivated white shrimp. Journal of Nanomaterials. 2019: 8214675.
Aranguren-Caro, L.F., Mai, H.N., Noble, B. and Dhar, A.K. 2020. Acute hepatopancreatic necrosis disease (VPAHPND), a chronic disease in shrimp (Penaeus vannamei) population raised in Latin America. Journal of Invertebrate Pathology. 174: 107424.
Bandeira-Junior, G., Erbice-Bianchi, A., de Freitas-Souza, C., Nunes-Descovi, S., da Silva-Fernandes, L., de Lima-Silva, L., Cargneluti, J.F. and Baldisserotto, B. 2022. The use of cinnamon essential oils in aquaculture: antibacterial, anesthetic, growth promoting, and antioxidant effects. Fishes. 7: 133.
Citarasu, T., Babu, M., Sekar, R. and Marian, M. 2002. Developing artemia enriched herbal diet for producing quality larvae in Penaeus monodon, Fabricius. Asian Fisheries Science. 15: 21-32.
Citarasu, T. 2010. Herbal biomedicines: A new opportunity for aquaculture industry. Aquaculture International. 18: 403-
414.
Citarasu, T., Babu, M.M. and Yilmaz, E. 2022. Alternative medications in shrimp health management for improved production. Aquaculture. 561: 738695.
de Souza-Valente, C. and Whan, A.H.L. 2021. Vibrio and major commercially important vibriosis diseases in decapod crustaceans. Journal of Invertebrate Pathology. 181: 107527. Dewi, N.R., Huang, H.T., Wu, Y.S., Liao, Z.H., Lin, Y.J., Lee, P.T.
and Nan, F.H.. 2021. Guava (Psidium guajava) leaf extract enhances immunity, growth, and resistance against Vibrio parahaemolyticus in white shrimp Penaeus vannamei. Fish & Shellfish Immunology. 118: 1-10.
Dhar, A., Piamsomboon, P., Caro, L.F., Kanrar, S., Adami, R. and Juan, Y.-S. 2019. First report of acute hepatopancreatic necrosis disease (AHPND) occurring in the USA. Diseases of Aquatic Organisms. 132: 241-247.
Eshik, M.E., Abedin, M., Punom, N., Begum, M.K. and Rahman,
M.S. 2017. Molecular identification of AHPND positive Vibrio Parahaemolyticus causing an outbreak in south-west shrimp farming regions of Bangladesh. Journal of Bangladesh Academy of Sciences. 41: 127-135.
Han, J., Tang, K. and Lightner, D. 2015a. Genotyping of virulence plasmid from Vibrio parahaemolyticus isolates causing acute hepatopancreatic necrosis disease in shrimp. Diseases of Aquatic Organisms. 115: 245-251.
Han, J.E., Tang, K.F.J., Tran, L.H. and Lightner, D. V. 2015b. Photorhabdus insect-related (Pir) toxin-like genes in a plasmid of Vibrio parahaemolyticus, the causative agent of acute hepatopancreatic necrosis disease (AHPND) of shrimp. Diseases of Aquatic Organisms. 113: 33-40.
Han, J.E., Tang, K.F.J., Aranguren, L.F. and Piamsomboon,
P. 2017. Characterization and pathogenicity of acute hepatopancreatic necrosis disease natural mutants, pirABvp (‐) V. parahaemolyticus, and pirABvp (+) V. campbellii strains. Aquaculture. 470: 84-90.
Kondo, H., Van, P., Dang, L.T. and Hirono, I. 2015. Draft genome sequence of non-Vibrio parahaemolyticus acute hepatopancreatic necrosis disease Sstrain KC13.17.5, isolated from diseased shrimp in Vietnam. Genome Announcements. 3: e00978-15
Kondo, H.,Tinwongger, S., Proespraiwong, P., Mavichak, R., Unajak, S., Nozaki, R. and Hirono, I. 2014. Draft genome sequences of six strains of Vibrio parahaemolyticus isolated from early mortality syndrome/acute hepatopancreatic necrosis disease shrimp in Thailand. Genome Announcements. 2: e00221-14
Kumar, R., Ng, T.H. and Wang, H. 2020. Acute hepatopancreatic necrosis disease in penaeid shrimp. Reviews in Aquaculture. 12: 1867-1880.
Le Nguyen, D.-A., Cheng, L.-W., Wang, P.-C. and Chen, S.-C. 2023. Phenotypic, phylogenetic analysis and pathogenic detection of Vibrio parahaemolyticus in farmed Penaeus vannamei in Taiwan. Taiwan Veterinary Journal. 48: 35-44.
Lightner, D., Redman, R.M., Pantoja, C.R., Noble, B.L. and Tran,
L. 2012. Early mortality syndrome affects shrimp in Asia. Responsible Seafood Advocate. 2012: 1-6.
Lihn, N.T.T., Ha, P.T.H., Day, P.V., Hay, L.T.T., Vu, S.H., Nghia, N.T.,
Dung, T.T., Phu, T.Q., Huyen, H.M., Do-Hyung, K. and Luan,
N.T. 2024. Efficacy of Annona glabra extract against acute hepatopancreatic necrosis disease in white-leg shrimp (Penaeus vannamei). Journal of Invertebrate Pathology. 205: 108142
Liu, L., Xiao, J., Zhang, M., Zhu, W., Xia, X., Dai, X., Pan, Y., Yan, S. and Wang, Y. 2018. A Vibrio owensii strain as the causative agent of AHPND in cultured shrimp, Litopenaeus vannamei. Journal of Invertebrate Pathology. 153: 156-164.
Loo, K., Letchumanan, V., Law, J.W., Pusparajah, P., Goh, B., Ab Mutalib, N., He, Y. and Lee, L. 2020. Incidence of antibiotic resistance in Vibrio spp. Reviews in Aquaculture. 12: 2590- 2608.
Lulijwa, R., Rupia, E. and Alfaro, A. 2019. Antibiotic use in aquaculture, policies and regulation, health and environmental risks: a review of the top 15 major producers. Reviews in Aquaculture. 12: 640-663.
Martínez-Aguilar, Y., Yero-Martínez, M., Liu, G., Ren, W., Rodríguez-Bertot, R., Jimenez-Fonseca, Y., Gonzalez-Olmo, C., Del Toro, M.I., Aroche-Ginarte, R., Valdivié-Navarro, M. and Nyachoti, C.M. 2013. Effect of dietary supplementation
with Anacardium occidentale on growth performance and immune and visceral organ weights in replacement laying pullets. Journal of Food, Agriculture and Environment. 11: 1352-1357.
Más,T.D., Aguilar, Y., Bertot, R., Torres, G., Nava, O. and Olmo- González, C. 2017. Preliminary analysis of secondary metabolites in mixed powders of leaves of medicinal plants. Revista Cubana de Plantas Medicinales. 22: 1-9.
Maurus, G., Ho, T.H. and Lee, P.T. 2023. Effects of dietary Scutellaria baicalensis extract on growth performance, immune- related genes expression, and resistance against Vibrio parahaemolyticus in white shrimp (Litopenaeus vannamei). Research in Veterinary Science. 159: 60-170.
Mišljenović, N., Čolović, R., Vukmirović, D., Brlek, T. and Salas- Bringas, C. 2016. The effects of sugar beet molasses on wheat straw pelleting and pellet quality. A comparative study of pelleting by using a single pellet press and a pilot- scale pellet press. Fuel Processing Technology. 144: 220-229. Muthukrishnan, S., Defoirdt, T., Ina-Salwany, M.Y., Yusoff, F.M., Shariff, M., Ismail, S.I. and Natrah, I. 2019. Vibrio parahaemolyticus and Vibrio harveyi causing acute hepatopancreatic necrosis disease (AHPND) in Penaeus vannamei (Boone, 1931) isolated from Malaysian shrimp
ponds. Aquaculture. 511: 734227.
Nguyen, H-T., Huang, H-T, Lin, Y-R., Chen, Y-Y., Nan, F-H and Hu, Y-F. 2024. Dietary Galla chinensis on white shrimp Penaeus vannamei: Promotes growth, nonspecific immunity, and disease resistance against Vibrio parahaemolyticus. Aquaculture Reports. 35: 102012.
Nunan, L., Lightner, D., Pantoja, C. and Gomez-Jimenez, S. 2014. Detection of acute hepatopancreatic necrosis disease (AHPND) in Mexico. Diseases of Aquatic Organisms. 111: 81-86.
Peña-Navarro, N., Castro-Vásquez, R., Vargas-Leitón, B. and Dolz,
G. 2020. Molecular detection of acute hepatopancreatic necrosis disease (AHPND) in Penaeus vannamei shrimps in Costa Rica. Aquaculture. 523: 735190.
Restrepo, L., Bayot, B., Arciniegas, S., Bajaña, L., Betancourt, I., Panchana González, F. and Reyes, A. 2018. PirVP genes causing AHPND identified in a new Vibrio species (Vibrio punensis) within the commensal Orientalis clade. Scientific Reports. 8:13080.
Sharifi, A., Mohammadzadeh, A., Salehi, T.Z., Mahmoodi, P. and Nourian, A. 2021. Cuminum cyminum L. essential oil: a promising antibacterial and antivirulence agent against multidrug-resistant Staphylococcus aureus. Frontiers in Microbiology. 12: 667833.
Shinn, A., Pratoomyot, J., Griffiths, D., Trọng, T., Nguyen, V., Jiravanichpaisal, P. and Briggs, M. 2018. Asian shrimp production and the economic costs of disease. Asian Fisheries Science. 31S: 29-58.
Sirikharin, R., Taengchaiyaphum, S., Sanguanrut, P., Duong, T., Mavichak, R., Proespraiwong, P., Nuangsaeng, B., Thitamadee, S., Flegel, T. and Sritunyalucksana, K. 2015. Characterization and PCR Detection Of Binary, Pir-Like Toxins from Vibrio parahaemolyticus Isolates that cause acute hepatopancreatic necrosis disease (AHPND) in Shrimp. PloS one. 10: 0126987.
Sivasankar, P., John, K.R., George, M.R., Anushalini, S.V, Kaviarasu,
D. and Petchimuthu, M. 2017. Prophylactics in shrimp aquaculture health management: A review. Journal of Entomology and Zoology Studies. 5: 1049-1055.
Soto-Rodriguez, S., Gomez-Gil, B., Lozano-Olvera, R., Betancourt- Lozano, M. and Morales-Covarrubias, M. 2015. Field and experimental evidence of Vibrio parahaemolyticus as the causative agent of acute hepatopancreatic necrosis disease of cultured shrimp (Litopenaeus vannamei) in northwestern Mexico. Applied and Environmental Microbiology. 81: 1689- 1699.
Soto-Rodriguez, S., Gomez-Gil, B., Lozano-Olvera, R., Bolan- Mejía, M., Aguilar-Rendon, K. and Enciso-Ibarra, J. 2018. Pathological, genomic and phenotypical characterization of Vibrio parahaemolyticus, causative agent of acute Hepatopancreatic Necrosis Disease (AHPND) in Mexico. Asian Fisheries Science. 31S: 102-111.
Tang, K.F.J. and Bondad-Reantaso, M.G. 2019. Impacts of acute hepatopancreatic necrosis disease on commercial shrimp aquaculture. Revue Scientifique et Technique. 38: 477-490.
Taniguchi, H., Ohta, H., Ogawa, M. and Mizuguchi, Y. 1985. Cloning and expression of Escherichia coli of Vibrio parahaemolyticus thermostable direct hemolysin and thermolabile hemolysin genes. Journal of Bacteriology. 162: 510-515.
Tanoguchi, H., Hirano, H., Kubomura, S., Higashi, K. and Mizuguchi, Y. 1986. Comparison of the nucleotide sequences
of the genes for the thermostable direct hemolysin and the thermolabile hemolysin from Vibrio parahaemolyticus. Microbial Pathogenesis. 5: 425-432.
Tran, L., Nunan, L., Redman, R., Mohney, L., Pantoja, C., Fitzsimmons, K. and Lightner, D. 2013. Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Diseases of Aquatic Organisms. 105: 45-55.
Volpe, M.G., Varricchio, E., Coccia, E., Santagata, G., Di Stasio, M., Malinconico, M. and Paolucci, M. 2012. Manufacturing pellets with different binders: Effect on water stability and feeding response in juvenile Cherax albidus. Aquaculture. 324-325: 104-110.
Ward L.N. and Bej, A.K. 2006. Detection of Vibrioparahaemolyticus in shellfish by use of multiplexed real-time PCR with TaqMan fluorescent probes. Applied and Environmental Microbiology. 72: 2031-2042.
Zago, V., Veschetti, L., Patuzzo, C., Malerba, G. and Lleo, M.M. 2020. Shewanella algae and Vibrio spp. strains isolated in Italian aquaculture farms are reservoirs of antibiotic resistant genes that might constitute a risk for human health. Marine Pollution Bulletin. 154: 111057.